Stem-loop sequence cel-mir-4926

AccessionMI0017713 (change log)
DescriptionCaenorhabditis elegans miR-4926 stem-loop
Stem-loop
   --                 u   uua 
5'   guaggagugaauuuuga uuu   u
     ||||||||||||||||| |||    
3'   cauucuuauuuaaaauu aaa   a
   ga                 u   ugu 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 6054951-6055002 [-]
sense
C27A12.6 ; C27A12.6; intron 4
Database links

Mature sequence cel-miR-4926

Accession MIMAT0020133
Sequence

1 - 

guaggagugaauuuugauuuu

 - 21

Get sequence
Deep sequencing20 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).