Stem-loop sequence cel-mir-4925

AccessionMI0017712 (change log)
DescriptionCaenorhabditis elegans miR-4925 stem-loop
Stem-loop
   --         u      - a     uugu 
5'   guaagugca auguuu c aaaac    u
     ||||||||| |||||| | |||||    c
3'   cauuuacgu uacaaa g uuuug    a
   ga         -      a c     uuaa 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1879562-1879620 [+]
sense
Y59E1B.1 ; Y59E1B.1; intron 2
Clustered miRNAs
< 10kb from cel-mir-4925
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-4925

Accession MIMAT0020132
Sequence

37 - 

uuucgaaaacauugcauuuacag

 - 59

Get sequence
Deep sequencing21 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).