Stem-loop sequence cel-mir-4923b

AccessionMI0017711 (change log)
DescriptionCaenorhabditis elegans miR-4923b stem-loop
Literature search

1 open access papers mention cel-mir-4923b
(2 sentences)

Stem-loop
   --           c     au    ug  a 
5'   guaagcaaauu ccguc  uuuc  ga a
     ||||||||||| |||||  ||||  ||  
3'   cauuuguuuaa ggcgg  aaag  uu u
   ga           c     -c    uu  a 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1879640-1879698 [+]
sense
Y59E1B.1 ; Y59E1B.1; intron 3
Clustered miRNAs
< 10kb from cel-mir-4923b
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-4923b

Accession MIMAT0020131
Sequence

38 - 

aacggcggcaauuuguuuacag

 - 59

Get sequence
Deep sequencing68 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).