Stem-loop sequence cel-mir-4924

AccessionMI0017710 (change log)
DescriptionCaenorhabditis elegans miR-4924 stem-loop
Stem-loop
   -g     auca              u 
5'   uaagu    ucaauauuaauaau g
     |||||    |||||||||||||| a
3'   auuca    gguuaugauuauua u
   ga     aaua              a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 10840863-10840916 [-]
sense
T11G6.5b.1 ; T11G6.5b.1; intron 5
T11G6.5a ; T11G6.5a; intron 6
T11G6.5b.2 ; T11G6.5b.2; intron 6
Database links

Mature sequence cel-miR-4924

Accession MIMAT0020130
Sequence

1 - 

guaaguaucaucaauauuaaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).