Stem-loop sequence cel-mir-4923a

AccessionMI0017709 (change log)
DescriptionCaenorhabditis elegans miR-4923a stem-loop
Stem-loop
   --        uu c     a      g aa 
5'   guaagcaa  g uucuc uuuuca a  u
     ||||||||  | ||||| |||||| |  u
3'   cauuuguu  c gagag aaaagu u  g
   ga        uu c     a      g au 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1879876-1879936 [+]
sense
Y59E1B.1 ; Y59E1B.1; intron 5
Clustered miRNAs
< 10kb from cel-mir-4923a
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-4923a

Accession MIMAT0020129
Sequence

39 - 

aaaagagagccuuuuguuuacag

 - 61

Get sequence
Deep sequencing23 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).