Stem-loop sequence cel-mir-4922-1

AccessionMI0017707 (change log)
DescriptionCaenorhabditis elegans miR-4922-1 stem-loop
Gene family MIPF0001229; mir-4922
Stem-loop
   --            auuucauauugaaaaaag 
5'   gugaguagaaca                  u
     ||||||||||||                  a
3'   cacuuaucuugu                  a
   ga            caauauaucuccuguuaa 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 3380145-3380209 [-]
sense
C04E12.10 ; C04E12.10; intron 11
Database links

Mature sequence cel-miR-4922

Accession MIMAT0020128
Sequence

44 - 

uauauaacuguucuauucacag

 - 65

Get sequence
Deep sequencing98 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).