Stem-loop sequence cel-mir-4921

AccessionMI0017706 (change log)
DescriptionCaenorhabditis elegans miR-4921 stem-loop
Stem-loop
   --     uu a     uca      a  uu 
5'   guaag  g ugagu   cacaua au  u
     |||||  | |||||   |||||| ||  g
3'   cguuc  u acuca   guguau ua  g
   ga     uu c     -cc      a  ua 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1879979-1880038 [+]
sense
Y59E1B.1 ; Y59E1B.1; intron 6
Clustered miRNAs
< 10kb from cel-mir-4921
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-4921

Accession MIMAT0020127
Sequence

39 - 

ugugccacucacuuucuugcag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).