Stem-loop sequence cel-mir-4920

AccessionMI0017705 (change log)
DescriptionCaenorhabditis elegans miR-4920 stem-loop
Stem-loop
   -- u      -a  uuu       -   u 
5'   g aaggaa  ac   ugaauuu cuu u
     | ||||||  ||   ||||||| |||  
3'   c uuucuu  ug   acuuaaa gag g
   ga u      ag  uuu       a   a 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 8133417-8133472 [-]
sense
F42G8.11 ; F42G8.11; intron 1
Database links

Mature sequence cel-miR-4920

Accession MIMAT0020126
Sequence

1 - 

guaaggaaaacuuuugaauuu

 - 21

Get sequence
Deep sequencing16 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).