Stem-loop sequence bfl-mir-34e

AccessionMI0017679 (change log)
DescriptionBranchiostoma floridae miR-34e stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   -c a       a u    c    c cgcc     c  a    guau 
5'   g gcccgcc g uugg agug g    uacag ug cccg    g
     | ||||||| | |||| |||| |    ||||| || ||||    a
3'   c cgggcgg c gacc ucac c    auguc ac gggc    c
   aa -       g c    c    a ----     -  c    acuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666704.1: 337119-337206 [+]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-34e
bfl-mir-34c-2GG666704.1: 335461-335552 [+]
bfl-mir-34eGG666704.1: 337119-337206 [+]
Database links

Mature sequence bfl-miR-34e

Accession MIMAT0020497
Sequence

15 - 

uggcagugcgcgccuacagcuga

 - 37

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).