Stem-loop sequence spu-mir-29b

Accession MI0017594
Description Strongylocentrotus purpuratus miR-29b stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
guaa     uc           au      a     uccuug 
    ucaca  uacuguuuucu  uggugc uagag      u
    |||||  |||||||||||  |||||| |||||      u
    agugu  augacgaaaga  accacg aucuu      u
-cag     uu           gu      -     cuucau 
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (Spur2.1) Overlapping transcripts
gb|DS001315|: 45863-45947 [-]
intergenic
Clustered miRNAs
< 10kb from spu-mir-29b
spu-mir-29a gb|DS001315|: 47606-47706 [-]
spu-mir-29b gb|DS001315|: 45863-45947 [-]
Database links

Mature sequence spu-miR-29b

Accession MIMAT0020067
Sequence

55 - 

uagcaccaugagaaagcaguau

 - 76

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).