Stem-loop sequence cel-mir-4816

AccessionMI0017546 (change log)
DescriptionCaenorhabditis elegans miR-4816 stem-loop
Stem-loop
   --       - -uuu             u    a 
5'   guaagug g    uuguagaucaaaa aguu a
     ||||||| |    ||||||||||||| ||||  
3'   cauucac c    aacaucuaguuuu uuaa g
   ga       g uuuu             -    a 
Get sequence
Deep sequencing
2785 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 6185080-6185144 [+]
sense
T09B4.2.1 ; T09B4.2.1; intron 3
T09B4.2.2 ; T09B4.2.2; intron 3
Database links

Mature sequence cel-miR-4816-5p

Accession MIMAT0020005
Previous IDscel-miR-4816
Sequence

1 - 

guaagugguuuuuguagaucaa

 - 22

Get sequence
Deep sequencing577 reads, 14 experiments
Evidence experimental; Illumina [1-2]
Database links

Mature sequence cel-miR-4816-3p

Accession MIMAT0020006
Previous IDscel-miR-4816*
Sequence

43 - 

aucuacaauuuucgcacuuacag

 - 65

Get sequence
Deep sequencing2202 reads, 17 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).