Stem-loop sequence cel-mir-4815

AccessionMI0017545 (change log)
DescriptionCaenorhabditis elegans miR-4815 stem-loop
Stem-loop
   uugcc    uc           g      a    g         cc   cu 
5'      ucgu  gucguauauuc ucguau uugc ucguacauu  gga  u
        ||||  ||||||||||| |||||| |||| |||||||||  |||   
3'      agcg  uagcauguaag agcgua aacg aguauguaa  ucu  c
   -guua    --           g      a    -         -a   uc 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 5668921-5669019 [-]
sense
T19E7.6.1 ; T19E7.6.1; intron 1
T19E7.6.2 ; T19E7.6.2; intron 1
Database links

Mature sequence cel-miR-4815

Accession MIMAT0020004
Sequence

62 - 

uguaugagcaaaaugcgagga

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).