Stem-loop sequence cel-mir-4814

AccessionMI0017544 (change log)
DescriptionCaenorhabditis elegans miR-4814 stem-loop
Stem-loop
   uaaa                              g        caacug 
5'     ccaacuuuacccacuucucaaccaacuuug ccacuuuu      c
       |||||||||||||||||||||||||||||| ||||||||       
3'     gguugaaaugggugaagaguugguugaaac ggugaaga      c
   aacg                              g        cacuua 
Get sequence
Deep sequencing
1014 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 13728414-13728513 [-]
sense
W06F12.2a ; W06F12.2a; intron 8
W06F12.2b ; W06F12.2b; intron 8
W06F12.2c ; W06F12.2c; intron 8
W06F12.2d ; W06F12.2d; intron 8
W06F12.2e ; W06F12.2e; intron 8
Database links

Mature sequence cel-miR-4814-5p

Accession MIMAT0020002
Previous IDscel-miR-4814*
Sequence

19 - 

uucucaaccaacuuuggccacu

 - 40

Get sequence
Deep sequencing23 reads, 10 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-4814-3p

Accession MIMAT0020003
Previous IDscel-miR-4814
Sequence

63 - 

ugggcaaaguugguugagaagu

 - 84

Get sequence
Deep sequencing987 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).