Stem-loop sequence cel-mir-4814

Accession MI0017544
Description Caenorhabditis elegans miR-4814 stem-loop
Stem-loop 
uaaa                              g        caacug 
    ccaacuuuacccacuucucaaccaacuuug ccacuuuu      c
    |||||||||||||||||||||||||||||| ||||||||       
    gguugaaaugggugaagaguugguugaaac ggugaaga      c
aacg                              g        cacuua
Get sequence
Deep sequencing
2 reads, 2 experiments
Genome context
Coordinates (WBcel215) Overlapping transcripts
III: 13728313-13728412 [-]
sense
W06F12.2e ; W06F12.2e; intron 8
W06F12.2c ; W06F12.2c; intron 8
W06F12.2b ; W06F12.2b; intron 8
W06F12.2d ; W06F12.2d; intron 8
W06F12.2a ; W06F12.2a; intron 8
W06F12.2e ; W06F12.2e; intron 8
W06F12.2c ; W06F12.2c; intron 8
W06F12.2b ; W06F12.2b; intron 8
W06F12.2d ; W06F12.2d; intron 8
W06F12.2a ; W06F12.2a; intron 8
W06F12.2e ; W06F12.2e; intron 8
W06F12.2c ; W06F12.2c; intron 8
W06F12.2b ; W06F12.2b; intron 8
W06F12.2d ; W06F12.2d; intron 8
W06F12.2a ; W06F12.2a; intron 8

Mature sequence cel-miR-4814-5p

Accession MIMAT0020002
Previous IDs cel-miR-4814*
Sequence

19 -  

uucucaaccaacuuuggccacu

 - 40

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence cel-miR-4814-3p

Accession MIMAT0020003
Previous IDs cel-miR-4814
Sequence

63 -  

ugggcaaaguugguugagaagu

 - 84

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).