Stem-loop sequence cel-mir-4813

AccessionMI0017543 (change log)
DescriptionCaenorhabditis elegans miR-4813 stem-loop
Literature search

2 open access papers mention cel-mir-4813
(2 sentences)

Stem-loop
   ---a                a  aa            uac 
5'     uuucaccagacuaucu gg  auauugaacuaa   a
       |||||||||||||||| ||  ||||||||||||    
3'     aaaguggucugguagg cc  uauaacuugauu   a
   aacg                -  -a            uua 
Get sequence
Deep sequencing
919 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 4571640-4571716 [+]
sense
F35G12.2.1 ; F35G12.2.1; exon 8
F35G12.2.2 ; F35G12.2.2; exon 9
F35G12.2.3 ; F35G12.2.3; exon 9
Database links

Mature sequence cel-miR-4813-5p

Accession MIMAT0020000
Previous IDscel-miR-4813*
Sequence

9 - 

agacuaucuaggaaauauugaacu

 - 32

Get sequence
Deep sequencing379 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-4813-3p

Accession MIMAT0020001
Previous IDscel-miR-4813
Sequence

47 - 

uucaauauaccggauggucugg

 - 68

Get sequence
Deep sequencing539 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).