Stem-loop sequence cel-mir-4812

AccessionMI0017542 (change log)
DescriptionCaenorhabditis elegans miR-4812 stem-loop
Gene family MIPF0000460; mir-1829
Literature search

1 open access papers mention cel-mir-4812
(2 sentences)

Stem-loop
   ----agaa   --    cgc        a       aaaa 
5'         gua  agag   uuguagug guuguca    u
           |||  ||||   |||||||| |||||||    u
3'         cau  ucuc   aacgucac caacagu    g
   gguuuuua   ua    uuu        -       auga 
Get sequence
Deep sequencing
421 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 15242774-15242849 [-]
sense
F39B1.1 ; F39B1.1; intron 7
Clustered miRNAs
< 10kb from cel-mir-4812
cel-mir-4812chrX: 15242774-15242849 [-]
cel-mir-1829cchrX: 15236362-15236423 [-]
Database links

Mature sequence cel-miR-4812-5p

Accession MIMAT0019998
Previous IDscel-miR-4812
Sequence

7 - 

aagagcgcuuguagugaguugu

 - 28

Get sequence
Deep sequencing100 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-4812-3p

Accession MIMAT0019999
Previous IDscel-miR-4812*
Sequence

45 - 

caaccacugcaauuucucuau

 - 65

Get sequence
Deep sequencing313 reads, 16 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).