Stem-loop sequence cel-mir-4809

Accession

MI0017539 (change log)

Description

Caenorhabditis elegans miR-4809 stem-loop

Stem-loop

   -- u         -    a      uugau 
5'   g aaguucaga guug auuauc     c
     | ||||||||| |||| ||||||      
3'   c uucgggucu caac uaauag     a
   ga c         u    a      uuuau 

Deep sequencing

23 reads, 0 reads per million, 9 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrX: 1873646-1873704 [+]
• Overlapping transcripts:

  sense

  Y59E1B.2 ; Y59E1B.2; intron 2

Clustered miRNAs

< 10kb from cel-mir-4809

• cel-mir-4807: chrX: 1872466-1872526 [+]
• cel-mir-4808: chrX: 1872952-1873008 [+]
• cel-mir-4809: chrX: 1873646-1873704 [+]
• cel-mir-2220: chrX: 1873827-1873884 [+]
• cel-mir-4810b: chrX: 1874016-1874075 [+]
• cel-mir-4810a: chrX: 1875738-1875794 [+]
• cel-mir-1018: chrX: 1879458-1879513 [+]
• cel-mir-4925: chrX: 1879562-1879620 [+]
• cel-mir-4923b: chrX: 1879640-1879698 [+]
• cel-mir-4923a: chrX: 1879876-1879936 [+]
• cel-mir-4921: chrX: 1879979-1880038 [+]

Database links

• miRBase Tracker:MI0017539

Mature sequence cel-miR-4809-5p

• Accession: MIMAT0019993
• Previous IDs: cel-miR-4809*
• Sequence: 1 - guaaguucagaguugaauuauc - 22
• Evidence: experimental; Illumina [1-2]

Mature sequence cel-miR-4809-3p

• Accession: MIMAT0019994
• Previous IDs: cel-miR-4809
• Sequence: 37 - uaauacaacuucugggcuuccag - 59
• Deep sequencing: 23 reads, 9 experiments
• Evidence: experimental; Illumina [1-2]

References

1. PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2. PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).