Stem-loop sequence cel-mir-4807

AccessionMI0017537 (change log)
DescriptionCaenorhabditis elegans miR-4807 stem-loop
Stem-loop
   --         -    ua         uaua 
5'   gugaguuca aagu  cauuuucaa    u
     ||||||||| ||||  |||||||||     
3'   cauucgggu uuca  guaaaaguu    c
   ga         c    gc         uuau 
Get sequence
Deep sequencing
650 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1872466-1872526 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-4807
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-4807

Accession MIMAT0019990
Sequence

39 - 

aaaugcgacuucugggcuuacag

 - 61

Get sequence
Deep sequencing649 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).