Stem-loop sequence cel-mir-4806

AccessionMI0017536 (change log)
DescriptionCaenorhabditis elegans miR-4806 stem-loop
Stem-loop
   gga     u        a              c    -     
5'    uucag ggcgagcc cuuaccggcugagc augc gcgc 
      ||||| |||||||| |||||||||||||| |||| ||| u
3'    agguu ccguucgg gaauggccgacucg uacg cgcg 
   -cg     u        a              a    u     
Get sequence
Deep sequencing
61 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 12346299-12346381 [-]
sense
C44C11.1a ; C44C11.1a; intron 4
Database links

Mature sequence cel-miR-4806-5p

Accession MIMAT0019988
Sequence

17 - 

cacuuaccggcugagccaugc

 - 37

Get sequence
Deep sequencing51 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-4806-3p

Accession MIMAT0019989
Sequence

50 - 

auagcucagccgguaagaggc

 - 70

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).