Stem-loop sequence cel-mir-4805

AccessionMI0017535 (change log)
DescriptionCaenorhabditis elegans miR-4805 stem-loop
Stem-loop
   -ag  g  gg             c      g c          uuu u 
5'    uc ga  caggggugugcgg aaauuu c gaauuugccg   g c
      || ||  ||||||||||||| |||||| | ||||||||||   | g
3'    ag cu  guccccacacgcc uuuaga g uuuaaacggc   c a
   ccg  g  -a             u      - u          --u g 
Get sequence
Deep sequencing
204 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 1061648-1061741 [+]
intergenic
Database links

Mature sequence cel-miR-4805-5p

Accession MIMAT0019986
Previous IDscel-miR-4805*
Sequence

18 - 

ugcggcaaauuugccgaauuugc

 - 40

Get sequence
Deep sequencing31 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-4805-3p

Accession MIMAT0019987
Previous IDscel-miR-4805
Sequence

58 - 

aaauuuugagauuuuccgcaca

 - 79

Get sequence
Deep sequencing107 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).