Stem-loop sequence tcc-MIR535

AccessionMI0017532 (change log)
DescriptionTheobroma cacao miR535 stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
   ac  c    -     -    ua         u               aca   c a   c 
5'   ag uuug uacau auca  ugacaacga agagagcacgcuugu   cau c ugu c
     || |||| ||||| ||||  ||||||||| |||||||||||||||   ||| | |||  
3'   uc aaac gugua uagu  acuguugcu ucucucgugcgagca   gua g acg u
   ac  u    u     a    ua         c               acc   a a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR535

Accession MIMAT0020448
Sequence

21 - 

ugacaacgauagagagcacgc

 - 41

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).