Stem-loop sequence tcc-MIR399i

AccessionMI0017527 (change log)
DescriptionTheobroma cacao miR399i stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   gu  a     -aaacca    a      c      a         aaua      uuacugcuguaauuaauuaugcaaa 
5'   ca uaagc       guca agggca cucucc uuggcaggu    uuguga                         g
     || |||||       |||| |||||| |||||| |||||||||    ||||||                         u
3'   gu auucg       cagu ucccgu gagagg aaccguuca    gacacu                         g
   -c  a     acuuaga    g      u      a         ----      uuacuucacgucccggccccucagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR399i

Accession MIMAT0020443
Sequence

117 - 

ugccaaaggagaguugcccug

 - 137

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).