Stem-loop sequence tcc-MIR399g

AccessionMI0017525 (change log)
DescriptionTheobroma cacao miR399g stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   ---ug     uu  c    aa   u     c           -c g     a    g 
5'      ugcag  ga gaau  cag gcagu cuucuuuggca  a agaag caug c
        |||||  || ||||  ||| ||||| |||||||||||  | ||||| |||| a
3'      acguc  uu cuua  guc cguua gaggaaaccgu  u ucuuc gugc u
   cauug     -c  a    cc   c     a           uu g     a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR399g

Accession MIMAT0020441
Sequence

72 - 

ugccaaaggagaauugcccug

 - 92

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).