Stem-loop sequence tcc-MIR399d

AccessionMI0017522 (change log)
DescriptionTheobroma cacao miR399d stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   ucucu     -----      auuaca     aa       a        cu  -    u    -u    aacc 
5'      ggugc     aguugc      gggca  gaucucc uuggcagg  gc cacu uggg  cacg    g
        |||||     ||||||      |||||  ||||||| ||||||||  || |||| ||||  ||||     
3'      uuacg     uuaacg      cccgu  uuagagg aaccgucu  ug guga aucc  gugu    a
   uauag     ccuuc      -----g     --       a        uc  u    u    uu    auua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR399d

Accession MIMAT0020438
Sequence

96 - 

ugccaaaggagauuugcccgg

 - 116

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).