Stem-loop sequence tcc-MIR399c

AccessionMI0017521 (change log)
DescriptionTheobroma cacao miR399c stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   uuuca c      u c   a a             c       c   c  ------------------uu    uuacc 
5'      g ugcagu g auu c gggcaaaucuuca uggcagg agc ac                    uggc     a
        | |||||| | ||| | ||||||||||||| ||||||| ||| ||                    ||||      
3'      c acguca c uaa g cccguuuagaggu accgucu ucg ug                    acug     u
   gguua a      c u   c a             a       c   -  uuauuuuuuuuuuuuuucgu    uccac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR399c

Accession MIMAT0020437
Sequence

101 - 

ugccaauggagauuugcccag

 - 121

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).