Stem-loop sequence tcc-MIR396e

AccessionMI0017515 (change log)
DescriptionTheobroma cacao miR396e stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   -------      c  uugc      a      a                augcuagcuauagcugcaccaaaagcgg 
5'        aguccu gu    cauguu uuccac gcuuucuugaacuucu                            c
          |||||| ||    |||||| |||||| ||||||||||||||||                             
3'        ucagga ca    guacga aaggug cgaaagaacuugaaga                            u
   acauuuu      -  ----      a      c                gaaaguuaaaaaagaaguauuaaaacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR396e

Accession MIMAT0020431
Sequence

21 - 

uuccacagcuuucuugaacuu

 - 41

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).