Stem-loop sequence tcc-MIR396c

AccessionMI0017513 (change log)
DescriptionTheobroma cacao miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention tcc-MIR396c
(2 sentences)

Stem-loop
   uu         ----      c                   a       u   aacgacucgaucucaaaaauauuag 
5'   gaagucuug    gccaug uuuuccacagcuuucuuga cuuucuu gug                         c
     |||||||||    |||||| ||||||||||||||||||| ||||||| |||                          
3'   uuucaggac    cgguac aaagggugucgaaagaacu gaaggag cac                         u
   --         uuaa      a                   c       c   acgauauaucgauaauagaucguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR396c

Accession MIMAT0020429
Sequence

21 - 

uuccacagcuuucuugaacuu

 - 41

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).