Stem-loop sequence tcc-MIR166c

Accession

MI0017469

Description

Theobroma cacao miR166c stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

ugaagaa      -ag     au             a   a     ---cc  cu  u  a     uc      
       gaaaag   ggugu  ggaaugaaguuug ucc agauc     uc  uc cc uaagu  uuauc 
       ||||||   |||||  ||||||||||||| ||| |||||     ||  || || |||||  |||| u
       cuuuuc   ccaca  ccuuacuucggac agg ucuag     ag  ag gg auuca  aauag 
-ucguuc      gua     cu             c   c     uuacu  uu  -  a     uu      

Mature sequence tcc-miR166c

• Accession: MIMAT0020385
• Sequence: 101 - ucggaccaggcuucauuccuc - 121
• Evidence: not experimental

References

1. PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).