Stem-loop sequence tcc-MIR156a

AccessionMI0017453
DescriptionTheobroma cacao miR156a stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -    aa  ucau  cc   u          -           -a       uc   u    a 
5'  gggg  ga    ga  aug ugacagaaga gagagagcaca  cccggca  agc aaag a
    ||||  ||    ||  ||| |||||||||| |||||||||||  |||||||  ||| |||| a
3'  cccc  cu    cu  uac acugucuucu cucuuucgugu  ggguugu  ucg uuuc g
   u    ca  -uuu  ac   c          u           ga       uu   -    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence tcc-miR156a

Accession MIMAT0020369
Sequence

21 - 

ugacagaagagagagagcaca

 - 41

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).