Stem-loop sequence hsa-mir-4804

AccessionMI0017452 (change log)
Symbol HGNC:MIR4804
DescriptionHomo sapiens miR-4804 stem-loop
Literature search

2 open access papers mention hsa-mir-4804
(2 sentences)

Stem-loop
              g  c                      
5' ucaguguauuu ga gguaagguuaagcaaggugcg 
   ||||||||||| || |||||||||||||||||||| u
3' agucacauaaa cu ccguuccaauucguucuaugc 
              g  c                      
Get sequence
Deep sequencing
748 reads, 3.8 reads per million, 79 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 72878591-72878663 [+]
intergenic
Database links

Mature sequence hsa-miR-4804-5p

Accession MIMAT0019984
Sequence

10 - 

uuggacgguaagguuaagcaa

 - 30

Get sequence
Deep sequencing711 reads, 67 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4804-3p

Accession MIMAT0019985
Sequence

45 - 

ugcuuaaccuugcccucgaaa

 - 65

Get sequence
Deep sequencing36 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).