Stem-loop sequence hsa-mir-4803

Accession MI0017451
Description Homo sapiens miR-4803 stem-loop
Gene family MIPF0001511; mir-4803
Stem-loop 
               a         a     ucaca 
agugggauuuaacau auagugugg uugaa     c
||||||||||||||| ||||||||| |||||      
uuacccuaaauugua uaucacacc aacuu     a
               g         c     uacac
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 71465294-71465367 [+]
sense
OTTHUMT00000218561 ; MAP1B-001; intron 2
OTTHUMT00000372647 ; MAP1B-003; intron 2
OTTHUMT00000218561 ; MAP1B-001; intron 2
OTTHUMT00000372647 ; MAP1B-003; intron 2
OTTHUMT00000218561 ; MAP1B-001; intron 2
OTTHUMT00000372647 ; MAP1B-003; intron 2
OTTHUMT00000373347 ; MAP1B-004; intron 3
OTTHUMT00000372646 ; MAP1B-002; intron 3
OTTHUMT00000373347 ; MAP1B-004; intron 3
OTTHUMT00000372646 ; MAP1B-002; intron 3
OTTHUMT00000373347 ; MAP1B-004; intron 3
OTTHUMT00000372646 ; MAP1B-002; intron 3
ENST00000296755 ; MAP1B-001; intron 2
ENST00000511641 ; MAP1B-003; intron 2
ENST00000296755 ; MAP1B-001; intron 2
ENST00000511641 ; MAP1B-003; intron 2
ENST00000296755 ; MAP1B-001; intron 2
ENST00000511641 ; MAP1B-003; intron 2
ENST00000512974 ; MAP1B-004; intron 3
ENST00000513526 ; MAP1B-002; intron 3
ENST00000512974 ; MAP1B-004; intron 3
ENST00000513526 ; MAP1B-002; intron 3
ENST00000512974 ; MAP1B-004; intron 3
ENST00000513526 ; MAP1B-002; intron 3
Database links

Mature sequence hsa-miR-4803

Accession MIMAT0019983
Sequence

10 -  

uaacauaauaguguggauuga

 - 30

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).