Stem-loop sequence hsa-mir-4802

Accession

MI0017450

Description

Homo sapiens miR-4802 stem-loop

Stem-loop

   ac        a        -   ga      u  ugu 
cug  uggcuugu uggagguu cua  ccaugu ag   u
|||  |||||||| |||||||| |||  |||||| ||   c
gac  accggacg acuuccaa ggu  gguaca uc   a
   ga        a        a   -a      -  uga 

Genome context

• Coordinates (GRCh37.p5): chr4: 40504057-40504136 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000250456 ; RBM47-001; intron 1

  OTTHUMT00000250457 ; RBM47-002; intron 1

  OTTHUMT00000362038 ; RBM47-015; intron 1

  OTTHUMT00000362035 ; RBM47-012; intron 1

  OTTHUMT00000250456 ; RBM47-001; intron 1

  OTTHUMT00000250457 ; RBM47-002; intron 1

  OTTHUMT00000362038 ; RBM47-015; intron 1

  OTTHUMT00000362035 ; RBM47-012; intron 1

  OTTHUMT00000250456 ; RBM47-001; intron 1

  OTTHUMT00000250457 ; RBM47-002; intron 1

  OTTHUMT00000362038 ; RBM47-015; intron 1

  OTTHUMT00000362035 ; RBM47-012; intron 1

  OTTHUMT00000362030 ; RBM47-007; intron 2

  OTTHUMT00000362029 ; RBM47-006; intron 2

  OTTHUMT00000362028 ; RBM47-005; intron 2

  OTTHUMT00000362034 ; RBM47-011; intron 2

  OTTHUMT00000362032 ; RBM47-009; intron 2

  OTTHUMT00000362036 ; RBM47-013; intron 2

  OTTHUMT00000362033 ; RBM47-010; intron 2

  OTTHUMT00000362030 ; RBM47-007; intron 2

  OTTHUMT00000362029 ; RBM47-006; intron 2

  OTTHUMT00000362028 ; RBM47-005; intron 2

  OTTHUMT00000362034 ; RBM47-011; intron 2

  OTTHUMT00000362032 ; RBM47-009; intron 2

  OTTHUMT00000362036 ; RBM47-013; intron 2

  OTTHUMT00000362033 ; RBM47-010; intron 2

  OTTHUMT00000362030 ; RBM47-007; intron 2

  OTTHUMT00000362029 ; RBM47-006; intron 2

  OTTHUMT00000362028 ; RBM47-005; intron 2

  OTTHUMT00000362034 ; RBM47-011; intron 2

  OTTHUMT00000362032 ; RBM47-009; intron 2

  OTTHUMT00000362036 ; RBM47-013; intron 2

  OTTHUMT00000362033 ; RBM47-010; intron 2

  OTTHUMT00000362031 ; RBM47-008; intron 3

  OTTHUMT00000362031 ; RBM47-008; intron 3

  OTTHUMT00000362031 ; RBM47-008; intron 3

  ENST00000381793 ; RBM47-001; intron 1

  ENST00000381795 ; RBM47-002; intron 1

  ENST00000513473 ; RBM47-015; intron 1

  ENST00000511902 ; RBM47-012; intron 1

  ENST00000381793 ; RBM47-001; intron 1

  ENST00000381795 ; RBM47-002; intron 1

  ENST00000513473 ; RBM47-015; intron 1

  ENST00000511902 ; RBM47-012; intron 1

  ENST00000381793 ; RBM47-001; intron 1

  ENST00000381795 ; RBM47-002; intron 1

  ENST00000513473 ; RBM47-015; intron 1

  ENST00000511902 ; RBM47-012; intron 1

  ENST00000510871 ; RBM47-007; intron 2

  ENST00000295971 ; RBM47-006; intron 2

  ENST00000514014 ; RBM47-005; intron 2

  ENST00000515053 ; RBM47-011; intron 2

  ENST00000505414 ; RBM47-009; intron 2

  ENST00000514782 ; RBM47-013; intron 2

  ENST00000505220 ; RBM47-010; intron 2

  ENST00000319592 ; RBM47-201; intron 2

  ENST00000510871 ; RBM47-007; intron 2

  ENST00000295971 ; RBM47-006; intron 2

  ENST00000514014 ; RBM47-005; intron 2

  ENST00000515053 ; RBM47-011; intron 2

  ENST00000505414 ; RBM47-009; intron 2

  ENST00000514782 ; RBM47-013; intron 2

  ENST00000505220 ; RBM47-010; intron 2

  ENST00000319592 ; RBM47-201; intron 2

  ENST00000510871 ; RBM47-007; intron 2

  ENST00000295971 ; RBM47-006; intron 2

  ENST00000514014 ; RBM47-005; intron 2

  ENST00000515053 ; RBM47-011; intron 2

  ENST00000505414 ; RBM47-009; intron 2

  ENST00000514782 ; RBM47-013; intron 2

  ENST00000505220 ; RBM47-010; intron 2

  ENST00000319592 ; RBM47-201; intron 2

  ENST00000511598 ; RBM47-008; intron 3

  ENST00000511598 ; RBM47-008; intron 3

  ENST00000511598 ; RBM47-008; intron 3

Database links

• ENTREZGENE: 100616274;MIR4802

Mature sequence hsa-miR-4802-5p

• Accession: MIMAT0019981
• Sequence: 13 - uauggagguucuagaccauguu - 34
• Evidence: experimental; Solexa [1,3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4802-5p
  • MIRDB:hsa-miR-4802-5p
  • TARGETMINER:hsa-miR-4802-5p

Mature sequence hsa-miR-4802-3p

• Accession: MIMAT0019982
• Sequence: 47 - uacauggauggaaaccuucaagc - 69
• Evidence: experimental; Solexa [1,3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4802-3p
  • MIRDB:hsa-miR-4802-3p
  • TARGETMINER:hsa-miR-4802-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
3. PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).