Stem-loop sequence hsa-mir-4799

Accession MI0017446
Description Homo sapiens miR-4799 stem-loop
Stem-loop
           c                     gag 
acugcuaauau uaaaugcagcaugccaguccu   a
||||||||||| |||||||||||||||||||||    
ugacgauuaua auuuacgucguacggucaggg   u
           u                     acg 
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 148703746-148703819 [+]
sense
OTTHUMT00000365006 ; ARHGAP10-002; intron 1
OTTHUMT00000365005 ; ARHGAP10-001; intron 1
OTTHUMT00000365006 ; ARHGAP10-002; intron 1
OTTHUMT00000365005 ; ARHGAP10-001; intron 1
OTTHUMT00000365006 ; ARHGAP10-002; intron 1
OTTHUMT00000365005 ; ARHGAP10-001; intron 1
ENST00000510379 ; ARHGAP10-002; intron 1
ENST00000336498 ; ARHGAP10-001; intron 1
ENST00000336498 ; ARHGAP10-001; intron 1
ENST00000510379 ; ARHGAP10-002; intron 1
ENST00000510379 ; ARHGAP10-002; intron 1
ENST00000336498 ; ARHGAP10-001; intron 1
Database links

Mature sequence hsa-miR-4799-5p

Accession MIMAT0019976
Sequence

10 - 

aucuaaaugcagcaugccaguc

 - 31

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4799-3p

Accession MIMAT0019977
Sequence

45 - 

acuggcaugcugcauuuauaua

 - 66

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).