|
miRBase |
|
Stem-loop sequence hsa-mir-4798 |
|||||
| Accession | MI0017445 | ||||
| Description | Homo sapiens miR-4798 stem-loop | ||||
| Gene family | MIPF0001574; mir-4798 | ||||
| Stem-loop |
ca a - u aagua acuucgguauacuuuguga uugg cuuu a ||||| ||||||||||||||||||| |||| |||| uucau ugaagccauaugaagcacu aacc gaaa c ac c a a |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4798-5p |
|
| Accession | MIMAT0019974 |
| Sequence |
10 - uucgguauacuuugugaauugg - 31 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4798-3p |
|
| Accession | MIMAT0019975 |
| Sequence |
47 - aacucacgaaguauaccgaagu - 68 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 2 |
PMID:21558790
"Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis"
RNA Biol. 8:378-383(2011).
|
| 3 |
PMID:21911355
"miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades"
Nucleic Acids Res. 40:37-52(2012).
|