Stem-loop sequence hsa-mir-4797

Accession MI0017444
Description Homo sapiens miR-4797 stem-loop
Stem-loop 
                             a   u 
gacucagaagacagagugccacuuacuga agg u
||||||||||||||||||||||||||||| ||| u
uugagucuucugucucacggugaaugacu ucu u
                             c   u
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 197020749-197020819 [-]
sense
OTTHUMT00000109227 ; DLG1-002; intron 2
OTTHUMT00000258187 ; DLG1-010; intron 2
OTTHUMT00000340310 ; DLG1-019; intron 2
OTTHUMT00000340318 ; DLG1-027; intron 2
OTTHUMT00000109227 ; DLG1-002; intron 2
OTTHUMT00000258187 ; DLG1-010; intron 2
OTTHUMT00000340310 ; DLG1-019; intron 2
OTTHUMT00000340318 ; DLG1-027; intron 2
OTTHUMT00000109227 ; DLG1-002; intron 2
OTTHUMT00000258187 ; DLG1-010; intron 2
OTTHUMT00000340310 ; DLG1-019; intron 2
OTTHUMT00000340318 ; DLG1-027; intron 2
OTTHUMT00000109228 ; DLG1-003; intron 3
OTTHUMT00000109230 ; DLG1-005; intron 3
OTTHUMT00000242864 ; DLG1-001; intron 3
OTTHUMT00000258166 ; DLG1-006; intron 3
OTTHUMT00000258169 ; DLG1-007; intron 3
OTTHUMT00000258170 ; DLG1-008; intron 3
OTTHUMT00000258171 ; DLG1-009; intron 3
OTTHUMT00000258192 ; DLG1-013; intron 3
OTTHUMT00000340308 ; DLG1-017; intron 3
OTTHUMT00000340309 ; DLG1-018; intron 3
OTTHUMT00000340313 ; DLG1-022; intron 3
OTTHUMT00000340314 ; DLG1-023; intron 3
OTTHUMT00000109228 ; DLG1-003; intron 3
OTTHUMT00000109230 ; DLG1-005; intron 3
OTTHUMT00000242864 ; DLG1-001; intron 3
OTTHUMT00000258166 ; DLG1-006; intron 3
OTTHUMT00000258169 ; DLG1-007; intron 3
OTTHUMT00000258170 ; DLG1-008; intron 3
OTTHUMT00000258171 ; DLG1-009; intron 3
OTTHUMT00000258192 ; DLG1-013; intron 3
OTTHUMT00000340308 ; DLG1-017; intron 3
OTTHUMT00000340309 ; DLG1-018; intron 3
OTTHUMT00000340313 ; DLG1-022; intron 3
OTTHUMT00000340314 ; DLG1-023; intron 3
OTTHUMT00000109228 ; DLG1-003; intron 3
OTTHUMT00000109230 ; DLG1-005; intron 3
OTTHUMT00000242864 ; DLG1-001; intron 3
OTTHUMT00000258166 ; DLG1-006; intron 3
OTTHUMT00000258169 ; DLG1-007; intron 3
OTTHUMT00000258170 ; DLG1-008; intron 3
OTTHUMT00000258171 ; DLG1-009; intron 3
OTTHUMT00000258192 ; DLG1-013; intron 3
OTTHUMT00000340308 ; DLG1-017; intron 3
OTTHUMT00000340309 ; DLG1-018; intron 3
OTTHUMT00000340313 ; DLG1-022; intron 3
OTTHUMT00000340314 ; DLG1-023; intron 3
ENST00000422288 ; DLG1-019; intron 2
ENST00000450955 ; DLG1-027; intron 2
ENST00000485409 ; DLG1-010; intron 2
ENST00000412364 ; DLG1-002; intron 2
ENST00000422288 ; DLG1-019; intron 2
ENST00000450955 ; DLG1-027; intron 2
ENST00000485409 ; DLG1-010; intron 2
ENST00000412364 ; DLG1-002; intron 2
ENST00000422288 ; DLG1-019; intron 2
ENST00000450955 ; DLG1-027; intron 2
ENST00000485409 ; DLG1-010; intron 2
ENST00000412364 ; DLG1-002; intron 2
ENST00000346964 ; DLG1-001; intron 3
ENST00000419354 ; DLG1-008; intron 3
ENST00000448528 ; DLG1-007; intron 3
ENST00000392382 ; DLG1-013; intron 3
ENST00000419227 ; DLG1-018; intron 3
ENST00000392381 ; DLG1-006; intron 3
ENST00000471733 ; DLG1-017; intron 3
ENST00000456699 ; DLG1-023; intron 3
ENST00000392380 ; DLG1-003; intron 3
ENST00000419553 ; DLG1-009; intron 3
ENST00000436682 ; DLG1-005; intron 3
ENST00000486877 ; DLG1-022; intron 3
ENST00000359922 ; DLG1-203; intron 3
ENST00000357674 ; DLG1-202; intron 3
ENST00000381807 ; DLG1-204; intron 3
ENST00000314062 ; DLG1-201; intron 3
ENST00000346964 ; DLG1-001; intron 3
ENST00000419354 ; DLG1-008; intron 3
ENST00000448528 ; DLG1-007; intron 3
ENST00000392382 ; DLG1-013; intron 3
ENST00000419227 ; DLG1-018; intron 3
ENST00000392381 ; DLG1-006; intron 3
ENST00000471733 ; DLG1-017; intron 3
ENST00000456699 ; DLG1-023; intron 3
ENST00000392380 ; DLG1-003; intron 3
ENST00000419553 ; DLG1-009; intron 3
ENST00000436682 ; DLG1-005; intron 3
ENST00000486877 ; DLG1-022; intron 3
ENST00000359922 ; DLG1-203; intron 3
ENST00000357674 ; DLG1-202; intron 3
ENST00000381807 ; DLG1-204; intron 3
ENST00000314062 ; DLG1-201; intron 3
ENST00000346964 ; DLG1-001; intron 3
ENST00000419354 ; DLG1-008; intron 3
ENST00000448528 ; DLG1-007; intron 3
ENST00000392382 ; DLG1-013; intron 3
ENST00000419227 ; DLG1-018; intron 3
ENST00000392381 ; DLG1-006; intron 3
ENST00000471733 ; DLG1-017; intron 3
ENST00000456699 ; DLG1-023; intron 3
ENST00000392380 ; DLG1-003; intron 3
ENST00000419553 ; DLG1-009; intron 3
ENST00000436682 ; DLG1-005; intron 3
ENST00000486877 ; DLG1-022; intron 3
ENST00000357674 ; DLG1-202; intron 3
ENST00000314062 ; DLG1-201; intron 3
Database links

Mature sequence hsa-miR-4797-5p

Accession MIMAT0019972
Sequence

10 -  

gacagagugccacuuacugaa

 - 30

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4797-3p

Accession MIMAT0019973
Sequence

41 -  

ucucaguaaguggcacucugu

 - 61

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).