|
miRBase |
|
Stem-loop sequence hsa-mir-4796 |
|||||
| Accession | MI0017443 | ||||
| Description | Homo sapiens miR-4796 stem-loop | ||||
| Gene family | MIPF0001402; mir-4796 | ||||
| Stem-loop |
--uu c uaaauuugugucuauacucugucacuuuacu uggc u ||||||||||||||||||||||||||||||| |||| c auuuaaacacagauaugagacggugaaauga acug a cguu a |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4796-5p |
|
| Accession | MIMAT0019970 |
| Sequence |
9 - ugucuauacucugucacuuuac - 30 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4796-3p |
|
| Accession | MIMAT0019971 |
| Sequence |
53 - uaaaguggcagaguauagacac - 74 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|