Stem-loop sequence hsa-mir-4794

Accession MI0017441
Description Homo sapiens miR-4794 stem-loop
Stem-loop 
u                    c         u uc u 
 uuuaacaucuggcuaucuca gagacugua g  c a
 |||||||||||||||||||| ||||||||| |  | a
 aaauuguagaccgauagagu cucugaugu c  g c
a                    a         u gu a
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 65045530-65045606 [+]
sense
OTTHUMT00000025033 ; CACHD1-002; intron 1
OTTHUMT00000025033 ; CACHD1-002; intron 1
OTTHUMT00000025033 ; CACHD1-002; intron 1
OTTHUMT00000025032 ; CACHD1-003; intron 2
OTTHUMT00000025238 ; CACHD1-001; intron 2
OTTHUMT00000025032 ; CACHD1-003; intron 2
OTTHUMT00000025238 ; CACHD1-001; intron 2
OTTHUMT00000025032 ; CACHD1-003; intron 2
OTTHUMT00000025238 ; CACHD1-001; intron 2
ENST00000470527 ; CACHD1-002; intron 1
ENST00000470527 ; CACHD1-002; intron 1
ENST00000470527 ; CACHD1-002; intron 1
ENST00000290039 ; CACHD1-001; intron 2
ENST00000495994 ; CACHD1-003; intron 2
ENST00000371073 ; CACHD1-201; intron 2
ENST00000290039 ; CACHD1-001; intron 2
ENST00000495994 ; CACHD1-003; intron 2
ENST00000371073 ; CACHD1-201; intron 2
ENST00000290039 ; CACHD1-001; intron 2
ENST00000495994 ; CACHD1-003; intron 2
ENST00000371073 ; CACHD1-201; intron 2
Database links

Mature sequence hsa-miR-4794

Accession MIMAT0019967
Sequence

9 -  

ucuggcuaucucacgagacugu

 - 30

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).