Stem-loop sequence hsa-mir-4790

Accession

MI0017437 (change log)

Symbol

HGNC:MIR4790

Description

Homo sapiens miR-4790 stem-loop

Literature search

1 open access papers mention hsa-mir-4790
(1 sentences)

Stem-loop

                                cac     gg 
5' caaugugacaucgcuuuaccauucauguu   ugaaa  u
   |||||||||||||||||||||||||||||   |||||   
3' guuacacuguagcgaaaugguaaguacaa   auuuu  a
                                -aa     ag 

Deep sequencing

25 reads, 52.9 reads per million, 17 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 5250177-5250255 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000337566 ; EDEM1-001; intron 8

  OTTHUMT00000337567 ; EDEM1-002; intron 8

  OTTHUMT00000337568 ; EDEM1-003; intron 8

  ENST00000256497 ; EDEM1-001; intron 8

  ENST00000465369 ; EDEM1-002; intron 8

  ENST00000445686 ; EDEM1-003; intron 8

Database links

• EntrezGene:MIR4790
• HGNC:MIR4790
• miRBase Tracker:MI0017437

Mature sequence hsa-miR-4790-5p

• Accession: MIMAT0019961
• Sequence: 10 - aucgcuuuaccauucauguu - 29
• Deep sequencing: 10 reads, 6 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4790-5p
  • TargetScanVert:hsa-miR-4790-5p
  • miRDB:hsa-miR-4790-5p

Mature sequence hsa-miR-4790-3p

• Accession: MIMAT0019962
• Sequence: 55 - ugaaugguaaagcgaugucaca - 76
• Deep sequencing: 10 reads, 7 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4790-3p
  • TargetScanVert:hsa-miR-4790-3p
  • miRDB:hsa-miR-4790-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).