|
miRBase |
|
Stem-loop sequence hsa-mir-4787 |
|||||
| Accession | MI0017434 | ||||
| Description | Homo sapiens miR-4787 stem-loop | ||||
| Stem-loop |
c ac - ---- g gg g cgguc ag guggcg ggggu ggcggcg cauccc ac g ||||| || |||||| ||||| ||||||| |||||| || c gccag uc cgccgc ccccg ccgccgc guaggg ug c - -- g ucac - ag u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4787-5p |
|
| Accession | MIMAT0019956 |
| Sequence |
14 - gcggggguggcggcggcauccc - 35 |
| Deep sequencing | 8 reads, 8 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4787-3p |
|
| Accession | MIMAT0019957 |
| Sequence |
51 - gaugcgccgcccacugccccgcgc - 74 |
| Deep sequencing | 8 reads, 4 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 2 |
PMID:21558790
"Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis"
RNA Biol. 8:378-383(2011).
|