Stem-loop sequence hsa-mir-1245b

Accession MI0017431
Description Homo sapiens miR-1245b stem-loop
Gene family MIPF0000620; mir-1245
Stem-loop 
u    a                 -  uaaa  -  a 
 uuau uguaggccuuuagauca cu    ga gu u
 |||| ||||||||||||||||| ||    || || u
 aaua auauccggaaaucuagu ga    cu ca c
a    c                 a  ----  a  a
Get sequence
Deep sequencing
3 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 189842819-189842887 [-]
antisense
OTTHUMT00000255899 ; COL3A1-001; intron 1
OTTHUMT00000313499 ; COL3A1-003; intron 1
OTTHUMT00000255899 ; COL3A1-001; intron 1
OTTHUMT00000313499 ; COL3A1-003; intron 1
OTTHUMT00000255899 ; COL3A1-001; intron 1
OTTHUMT00000313499 ; COL3A1-003; intron 1
ENST00000304636 ; COL3A1-001; intron 1
ENST00000470167 ; COL3A1-003; intron 1
ENST00000317840 ; COL3A1-201; intron 1
ENST00000408575 ; MIR1245-201; exon 1
ENST00000304636 ; COL3A1-001; intron 1
ENST00000470167 ; COL3A1-003; intron 1
ENST00000317840 ; COL3A1-201; intron 1
ENST00000408575 ; MIR1245A-201; exon 1
ENST00000304636 ; COL3A1-001; intron 1
ENST00000470167 ; COL3A1-003; intron 1
ENST00000317840 ; COL3A1-201; intron 1
ENST00000408575 ; MIR1245A-201; exon 1
Clustered miRNAs
< 10kb from hsa-mir-1245b
hsa-mir-1245b chr2: 189842819-189842887 [-]
hsa-mir-1245a chr2: 189842818-189842887 [+]
Database links

Mature sequence hsa-miR-1245b-5p

Accession MIMAT0019950
Sequence

9 -  

uaggccuuuagaucacuuaaa

 - 29

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-1245b-3p

Accession MIMAT0019951
Sequence

42 -  

ucagaugaucuaaaggccuaua

 - 63

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).