Stem-loop sequence hsa-mir-4785

Accession

MI0017430

Description

Homo sapiens miR-4785 stem-loop

Stem-loop

guag      -ac      g     -   cu   - u 
    gugggg   gcggcg cgcug cuc  ccg c g
    ||||||   |||||| ||||| |||  ||| |  
    cgccuc   cgccgc gcggc gag  ggc g c
cgcg      gac      a     u   ag   c c 

Deep sequencing

26 reads, 6 experiments

Genome context

• Coordinates (GRCh37.p5): chr2: 161264321-161264393 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000255043 ; RBMS1-001; intron 1

  OTTHUMT00000334068 ; RBMS1-006; intron 1

  OTTHUMT00000334071 ; RBMS1-009; intron 1

  OTTHUMT00000334069 ; RBMS1-007; 5'UTR (exon 1)

  OTTHUMT00000334067 ; RBMS1-005; intron 1

  OTTHUMT00000334280 ; RBMS1-015; intron 1

  OTTHUMT00000334279 ; RBMS1-014; intron 1

  OTTHUMT00000255043 ; RBMS1-001; intron 1

  OTTHUMT00000334068 ; RBMS1-006; intron 1

  OTTHUMT00000334071 ; RBMS1-009; intron 1

  OTTHUMT00000334069 ; RBMS1-007; 5'UTR (exon 1)

  OTTHUMT00000334067 ; RBMS1-005; intron 1

  OTTHUMT00000334280 ; RBMS1-015; intron 1

  OTTHUMT00000334279 ; RBMS1-014; intron 1

  OTTHUMT00000255043 ; RBMS1-001; intron 1

  OTTHUMT00000334068 ; RBMS1-006; intron 1

  OTTHUMT00000334071 ; RBMS1-009; intron 1

  OTTHUMT00000334069 ; RBMS1-007; 5'UTR (exon 1)

  OTTHUMT00000334067 ; RBMS1-005; intron 1

  OTTHUMT00000334280 ; RBMS1-015; intron 1

  OTTHUMT00000334279 ; RBMS1-014; intron 1

  OTTHUMT00000255044 ; RBMS1-002; intron 2

  OTTHUMT00000255044 ; RBMS1-002; intron 2

  OTTHUMT00000255044 ; RBMS1-002; intron 2

  ENST00000348849 ; RBMS1-001; intron 1

  ENST00000409075 ; RBMS1-006; intron 1

  ENST00000409289 ; RBMS1-009; intron 1

  ENST00000409972 ; RBMS1-007; 5'UTR (exon 1)

  ENST00000491781 ; RBMS1-005; intron 1

  ENST00000428519 ; RBMS1-015; intron 1

  ENST00000477486 ; RBMS1-014; intron 1

  ENST00000392753 ; RBMS1-201; intron 1

  ENST00000348849 ; RBMS1-001; intron 1

  ENST00000409075 ; RBMS1-006; intron 1

  ENST00000409289 ; RBMS1-009; intron 1

  ENST00000409972 ; RBMS1-007; 5'UTR (exon 1)

  ENST00000491781 ; RBMS1-005; intron 1

  ENST00000428519 ; RBMS1-015; intron 1

  ENST00000477486 ; RBMS1-014; intron 1

  ENST00000392753 ; RBMS1-201; intron 1

  ENST00000348849 ; RBMS1-001; intron 1

  ENST00000409075 ; RBMS1-006; intron 1

  ENST00000409289 ; RBMS1-009; intron 1

  ENST00000409972 ; RBMS1-007; 5'UTR (exon 1)

  ENST00000491781 ; RBMS1-005; intron 1

  ENST00000428519 ; RBMS1-015; intron 1

  ENST00000477486 ; RBMS1-014; intron 1

  ENST00000392753 ; RBMS1-201; intron 1

  ENST00000474820 ; RBMS1-002; intron 2

  ENST00000474820 ; RBMS1-002; intron 2

  ENST00000474820 ; RBMS1-002; intron 2

Database links

• ENTREZGENE: 100616364;MIR4785

Mature sequence hsa-miR-4785

• Accession: MIMAT0019949
• Sequence: 44 - agagucggcgacgccgccagc - 64
• Deep sequencing: 25 reads, 5 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4785
  • MIRDB:hsa-miR-4785
  • TARGETMINER:hsa-miR-4785

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).