Stem-loop sequence hsa-mir-4784

Accession MI0017429
Description Homo sapiens miR-4784 stem-loop
Stem-loop 
u   -  g cu     gau  u     u   a  gu a 
 gac ug g  gagga   gc gggac gag gu  c u
 ||| || |  |||||   || ||||| ||| ||  | g
 uug ac c  cuccu   cg cccug cuc cg  g g
g   u  g cu     acu  u     c   -  ag u
Get sequence
Deep sequencing
4 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 132248733-132248809 [-]
sense
OTTHUMT00000331817 ; FAM128A-007; intron 1
OTTHUMT00000331817 ; FAM128A-007; intron 1
OTTHUMT00000331817 ; FAM128A-007; intron 1
OTTHUMT00000331818 ; FAM128A-008; intron 2
OTTHUMT00000331812 ; FAM128A-002; intron 2
OTTHUMT00000331813 ; FAM128A-003; intron 2
OTTHUMT00000331811 ; FAM128A-001; intron 2
OTTHUMT00000331814 ; FAM128A-004; exon 2
OTTHUMT00000331818 ; FAM128A-008; intron 2
OTTHUMT00000331812 ; FAM128A-002; intron 2
OTTHUMT00000331813 ; FAM128A-003; intron 2
OTTHUMT00000331811 ; FAM128A-001; intron 2
OTTHUMT00000331814 ; FAM128A-004; exon 2
OTTHUMT00000331818 ; FAM128A-008; intron 2
OTTHUMT00000331812 ; FAM128A-002; intron 2
OTTHUMT00000331813 ; FAM128A-003; intron 2
OTTHUMT00000331811 ; FAM128A-001; intron 2
OTTHUMT00000331814 ; FAM128A-004; exon 2
ENST00000488586 ; MZT2A-007; intron 1
ENST00000488586 ; MZT2A-007; intron 1
ENST00000488586 ; MZT2A-007; intron 1
ENST00000427024 ; MZT2A-008; intron 2
ENST00000445782 ; MZT2A-002; intron 2
ENST00000410036 ; MZT2A-003; intron 2
ENST00000309451 ; MZT2A-001; intron 2
ENST00000491265 ; MZT2A-004; exon 2
ENST00000427024 ; MZT2A-008; intron 2
ENST00000445782 ; MZT2A-002; intron 2
ENST00000410036 ; MZT2A-003; intron 2
ENST00000309451 ; MZT2A-001; intron 2
ENST00000491265 ; MZT2A-004; exon 2
ENST00000427024 ; MZT2A-008; intron 2
ENST00000445782 ; MZT2A-002; intron 2
ENST00000410036 ; MZT2A-003; intron 2
ENST00000309451 ; MZT2A-001; intron 2
ENST00000491265 ; MZT2A-004; exon 2
Database links

Mature sequence hsa-miR-4784

Accession MIMAT0019948
Sequence

10 -  

ugaggagaugcugggacuga

 - 29

Get sequence
Deep sequencing 4 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).