Stem-loop sequence hsa-mir-4783

Accession MI0017428
Description Homo sapiens miR-4783 stem-loop
Stem-loop 
   aa     a          -   u  c     g    cg 
ggg  agcgg gggcgcgccc agc cc gggcu auug  c
|||  ||||| |||||||||| ||| || ||||| ||||   
ccc  ucgcc ucugcgcggg uug gg cccgg ugac  u
   cg     g          g   u  c     -    aa
Get sequence
Deep sequencing
7 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 128181113-128181194 [-]
antisense
OTTHUMT00000331026 ; PROC-011; intron 1
OTTHUMT00000331027 ; PROC-012; intron 1
OTTHUMT00000331026 ; PROC-011; intron 1
OTTHUMT00000331027 ; PROC-012; intron 1
OTTHUMT00000331026 ; PROC-011; intron 1
OTTHUMT00000331027 ; PROC-012; intron 1
OTTHUMT00000331017 ; PROC-002; intron 4
OTTHUMT00000331017 ; PROC-002; intron 4
OTTHUMT00000331017 ; PROC-002; intron 4
OTTHUMT00000254385 ; PROC-001; intron 6
OTTHUMT00000331025 ; PROC-010; intron 6
OTTHUMT00000254385 ; PROC-001; intron 6
OTTHUMT00000331025 ; PROC-010; intron 6
OTTHUMT00000254385 ; PROC-001; intron 6
OTTHUMT00000331025 ; PROC-010; intron 6
ENST00000464089 ; PROC-011; intron 1
ENST00000402125 ; PROC-012; intron 1
ENST00000464089 ; PROC-011; intron 1
ENST00000402125 ; PROC-012; intron 1
ENST00000464089 ; PROC-011; intron 1
ENST00000402125 ; PROC-012; intron 1
ENST00000409048 ; PROC-002; intron 4
ENST00000409048 ; PROC-002; intron 4
ENST00000409048 ; PROC-002; intron 4
ENST00000453608 ; PROC-202; intron 5
ENST00000422777 ; PROC-201; intron 5
ENST00000453608 ; PROC-202; intron 5
ENST00000422777 ; PROC-201; intron 5
ENST00000453608 ; PROC-202; intron 5
ENST00000422777 ; PROC-201; intron 5
ENST00000234071 ; PROC-001; intron 6
ENST00000442644 ; PROC-010; intron 6
ENST00000537436 ; PROC-203; intron 6
ENST00000234071 ; PROC-001; intron 6
ENST00000442644 ; PROC-010; intron 6
ENST00000537436 ; PROC-203; intron 6
ENST00000234071 ; PROC-001; intron 6
ENST00000442644 ; PROC-010; intron 6
Database links

Mature sequence hsa-miR-4783-5p

Accession MIMAT0019946
Sequence

13 -  

ggcgcgcccagcucccgggcu

 - 33

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4783-3p

Accession MIMAT0019947
Sequence

51 -  

ccccgguguuggggcgcgucugc

 - 73

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).