Stem-loop sequence hsa-mir-4782

Accession

MI0017427

Description

Homo sapiens miR-4782 stem-loop

Gene family

MIPF0001546; mir-4782

Stem-loop

                                  aaga 
auugcccaguucuggauaugaagacaaucaagaa    u
||||||||||||||||||||||||||||||||||    u
ugacgggucaagaucuauacuucuguuaguucuu    u
                                  gugg 

Genome context

• Coordinates (GRCh37.p5): chr2: 114478867-114478945 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000331376 ; SLC35F5-010; intron 1

  OTTHUMT00000331376 ; SLC35F5-010; intron 1

  OTTHUMT00000331376 ; SLC35F5-010; intron 1

  OTTHUMT00000331375 ; SLC35F5-009; intron 2

  OTTHUMT00000331375 ; SLC35F5-009; intron 2

  OTTHUMT00000331375 ; SLC35F5-009; intron 2

  OTTHUMT00000331378 ; SLC35F5-012; intron 3

  OTTHUMT00000331378 ; SLC35F5-012; intron 3

  OTTHUMT00000331378 ; SLC35F5-012; intron 3

  OTTHUMT00000331372 ; SLC35F5-006; intron 7

  OTTHUMT00000331372 ; SLC35F5-006; intron 7

  OTTHUMT00000331372 ; SLC35F5-006; intron 7

  OTTHUMT00000254150 ; SLC35F5-001; intron 13

  OTTHUMT00000330970 ; SLC35F5-002; intron 13

  OTTHUMT00000254150 ; SLC35F5-001; intron 13

  OTTHUMT00000330970 ; SLC35F5-002; intron 13

  OTTHUMT00000254150 ; SLC35F5-001; intron 13

  OTTHUMT00000330970 ; SLC35F5-002; intron 13

  ENST00000469702 ; SLC35F5-010; intron 1

  ENST00000469702 ; SLC35F5-010; intron 1

  ENST00000469702 ; SLC35F5-010; intron 1

  ENST00000459683 ; SLC35F5-009; intron 2

  ENST00000459683 ; SLC35F5-009; intron 2

  ENST00000459683 ; SLC35F5-009; intron 2

  ENST00000470204 ; SLC35F5-012; intron 3

  ENST00000470204 ; SLC35F5-012; intron 3

  ENST00000470204 ; SLC35F5-012; intron 3

  ENST00000447673 ; SLC35F5-006; intron 7

  ENST00000447673 ; SLC35F5-006; intron 7

  ENST00000447673 ; SLC35F5-006; intron 7

  ENST00000245680 ; SLC35F5-001; intron 13

  ENST00000409106 ; SLC35F5-002; intron 13

  ENST00000245680 ; SLC35F5-001; intron 13

  ENST00000409106 ; SLC35F5-002; intron 13

  ENST00000245680 ; SLC35F5-001; intron 13

  ENST00000409106 ; SLC35F5-002; intron 13

Database links

• ENTREZGENE: 100616208;MIR4782

Mature sequence hsa-miR-4782-5p

• Accession: MIMAT0019944
• Sequence: 10 - uucuggauaugaagacaaucaa - 31
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4782-5p
  • MIRDB:hsa-miR-4782-5p
  • TARGETMINER:hsa-miR-4782-5p

Mature sequence hsa-miR-4782-3p

• Accession: MIMAT0019945
• Sequence: 50 - ugauugucuucauaucuagaac - 71
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4782-3p
  • MIRDB:hsa-miR-4782-3p
  • TARGETMINER:hsa-miR-4782-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).