Stem-loop sequence hsa-mir-4436b-1

Accession MI0017425
Previous IDs hsa-mir-4436b
Description Homo sapiens miR-4436b-1 stem-loop
Gene family MIPF0001236; mir-4436
Stem-loop 
   u                  g            aaaugg    g 
gug ccucacuuguccacuucu ccugcccugccc      ugga c
||| |||||||||||||||||| ||||||||||||      |||| a
uac ggagugaacaggugaaga ggacgggacggg      gcuu g
   c                  a            ----ga    a
Get sequence
Deep sequencing
14 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 110844010-110844100 [-]
sense
OTTHUMT00000338105 ; MALL-002; intron 1
OTTHUMT00000338105 ; MALL-002; intron 1
OTTHUMT00000338105 ; MALL-002; intron 1
OTTHUMT00000253921 ; MALL-001; intron 3
OTTHUMT00000253921 ; MALL-001; intron 3
OTTHUMT00000253921 ; MALL-001; intron 3
OTTHUMT00000338106 ; MALL-003; intron 4
OTTHUMT00000338106 ; MALL-003; intron 4
OTTHUMT00000338106 ; MALL-003; intron 4
ENST00000427178 ; MALL-002; intron 1
ENST00000427178 ; MALL-002; intron 1
ENST00000427178 ; MALL-002; intron 1
ENST00000272462 ; MALL-001; intron 3
ENST00000272462 ; MALL-001; intron 3
ENST00000272462 ; MALL-001; intron 3
ENST00000424988 ; MALL-003; intron 4
ENST00000424988 ; MALL-003; intron 4
ENST00000424988 ; MALL-003; intron 4
Database links

Mature sequence hsa-miR-4436b-5p

Accession MIMAT0019940
Sequence

13 -  

guccacuucugccugcccugcc

 - 34

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4436b-3p

Accession MIMAT0019941
Sequence

60 -  

cagggcaggaagaaguggacaa

 - 81

Get sequence
Deep sequencing 13 reads, 8 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).