|
miRBase |
|
Stem-loop sequence hsa-mir-4780 |
|||||
| Accession | MI0017424 | ||||
| Description | Homo sapiens miR-4780 stem-loop | ||||
| Stem-loop |
-- gc ca ac c aaa g cagugc gggggucaggcucaagg cag cc g | |||||| ||||||||||||||||| ||| || c gucacg ucccuaguccgaguucc guc gg g cc ua -a ca c acc |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4780 |
|
| Accession | MIMAT0019939 |
| Sequence |
51 - acccuugagccugaucccuagc - 72 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|