Stem-loop sequence hsa-mir-4780

Accession

MI0017424

Description

Homo sapiens miR-4780 stem-loop

Stem-loop

-- gc      ca                 ac   c  aaa 
  g  cagugc  gggggucaggcucaagg  cag cc   g
  |  ||||||  |||||||||||||||||  ||| ||    
  c  gucacg  ucccuaguccgaguucc  guc gg   g
cc ua      -a                 ca   c  acc 

Genome context

• Coordinates (GRCh37.p5): chr2: 88382038-88382118 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000338229 ; SMYD1-001; intron 1

  OTTHUMT00000338230 ; SMYD1-002; intron 1

  OTTHUMT00000338231 ; SMYD1-003; intron 1

  OTTHUMT00000338229 ; SMYD1-001; intron 1

  OTTHUMT00000338230 ; SMYD1-002; intron 1

  OTTHUMT00000338231 ; SMYD1-003; intron 1

  OTTHUMT00000338229 ; SMYD1-001; intron 1

  OTTHUMT00000338230 ; SMYD1-002; intron 1

  OTTHUMT00000338231 ; SMYD1-003; intron 1

  ENST00000438570 ; SMYD1-003; intron 1

  ENST00000444564 ; SMYD1-002; intron 1

  ENST00000419482 ; SMYD1-001; intron 1

  ENST00000295833 ; SMYD1-201; intron 1

  ENST00000419482 ; SMYD1-001; intron 1

  ENST00000444564 ; SMYD1-002; intron 1

  ENST00000438570 ; SMYD1-003; intron 1

  ENST00000295833 ; SMYD1-201; intron 1

  ENST00000419482 ; SMYD1-001; intron 1

  ENST00000444564 ; SMYD1-002; intron 1

  ENST00000438570 ; SMYD1-003; intron 1

Database links

• ENTREZGENE: 100616447;MIR4780

Mature sequence hsa-miR-4780

• Accession: MIMAT0019939
• Sequence: 51 - acccuugagccugaucccuagc - 72
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4780
  • MIRDB:hsa-miR-4780
  • TARGETMINER:hsa-miR-4780

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).