|
miRBase |
|
Stem-loop sequence hsa-mir-4773-1 |
||||||
| Accession | MI0017415 | |||||
| Description | Homo sapiens miR-4773-1 stem-loop | |||||
| Gene family | MIPF0001250; mir-4773 | |||||
| Stem-loop |
u auu
gcuccccagccuuucuaugcuccuguucugcuuu u
||||||||||||||||||||||||||||||||||
cgaggggucggaaagauacgaggacaagacgaaa c
a cua
|
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-4773 |
|
| Accession | MIMAT0019928 |
| Sequence |
48 - cagaacaggagcauagaaaggc - 69 |
| Deep sequencing | 4 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|