Stem-loop sequence hsa-mir-4772

Accession MI0017414
Description Homo sapiens miR-4772 stem-loop
Stem-loop 
                       a      a    cuu 
gugauugccucugaucaggcaaa uugcag cugu   c
||||||||||||||||||||||| |||||| ||||    
cacugacggagacuaguccguuu aacguc gaua   c
                       c      c    aac
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 103048749-103048826 [+]
sense
OTTHUMT00000329495 ; IL18RAP-002; intron 3
OTTHUMT00000329495 ; IL18RAP-002; intron 3
OTTHUMT00000329495 ; IL18RAP-002; intron 3
OTTHUMT00000253291 ; IL18RAP-001; intron 5
OTTHUMT00000253291 ; IL18RAP-001; intron 5
OTTHUMT00000253291 ; IL18RAP-001; intron 5
ENST00000409369 ; IL18RAP-002; intron 3
ENST00000409369 ; IL18RAP-002; intron 3
ENST00000409369 ; IL18RAP-002; intron 3
ENST00000264260 ; IL18RAP-001; intron 5
ENST00000264260 ; IL18RAP-001; intron 5
ENST00000264260 ; IL18RAP-001; intron 5
Database links

Mature sequence hsa-miR-4772-5p

Accession MIMAT0019926
Sequence

12 -  

ugaucaggcaaaauugcagacu

 - 33

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

Mature sequence hsa-miR-4772-3p

Accession MIMAT0019927
Sequence

48 -  

ccugcaacuuugccugaucaga

 - 69

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).