|
miRBase |
|
Stem-loop sequence hsa-mir-4771-2 |
|||||
| Accession | MI0017413 | ||||
| Description | Homo sapiens miR-4771-2 stem-loop | ||||
| Gene family | MIPF0001258; mir-4771 | ||||
| Stem-loop |
c u a u -c u gcucuag cuaauu uag uc ggucugcuu ag u ||||||| |||||| ||| || ||||||||| || u cgagauc gauuaa auc ag ucagacgaa uc c c c c u cc a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4771 |
|
| Accession | MIMAT0019925 |
| Sequence |
45 - agcagacuugaccuacaauua - 65 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|