Stem-loop sequence hsa-mir-4771-2

Accession MI0017413
Description Homo sapiens miR-4771-2 stem-loop
Gene family MIPF0001258; mir-4771
Stem-loop 
       c      u   a  u         -c  u 
gcucuag cuaauu uag uc ggucugcuu  ag u
||||||| |||||| ||| || |||||||||  || u
cgagauc gauuaa auc ag ucagacgaa  uc c
       c      c   c  u         cc  a
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 112528638-112528711 [-]
sense
OTTHUMT00000330441 ; ANAPC1-007; intron 3
OTTHUMT00000330441 ; ANAPC1-007; intron 3
OTTHUMT00000330441 ; ANAPC1-007; intron 3
OTTHUMT00000330439 ; ANAPC1-005; intron 36
OTTHUMT00000330439 ; ANAPC1-005; intron 36
OTTHUMT00000330439 ; ANAPC1-005; intron 36
OTTHUMT00000254045 ; ANAPC1-001; intron 47
OTTHUMT00000254045 ; ANAPC1-001; intron 47
OTTHUMT00000254045 ; ANAPC1-001; intron 47
ENST00000462785 ; ANAPC1-007; intron 3
ENST00000462785 ; ANAPC1-007; intron 3
ENST00000462785 ; ANAPC1-007; intron 3
ENST00000427997 ; ANAPC1-005; intron 36
ENST00000427997 ; ANAPC1-005; intron 36
ENST00000427997 ; ANAPC1-005; intron 36
ENST00000341068 ; ANAPC1-001; intron 47
ENST00000341068 ; ANAPC1-001; intron 47
ENST00000341068 ; ANAPC1-001; intron 47
Database links

Mature sequence hsa-miR-4771

Accession MIMAT0019925
Sequence

45 -  

agcagacuugaccuacaauua

 - 65

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).