|
miRBase |
|
Stem-loop sequence hsa-mir-4769 |
|||||
| Accession | MI0017410 | ||||
| Description | Homo sapiens miR-4769 stem-loop | ||||
| Stem-loop |
ga -- u a a u aaaa ggagaggu ggga ggag ga ggua gagcu a |||||||| |||| |||| || |||| ||||| u ccucuuca cccu ccuc cu ccgu cucga c cc uc c - a - accc |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4769-5p |
|
| Accession | MIMAT0019922 |
| Sequence |
8 - ggugggauggagagaagguaugag - 31 |
| Deep sequencing | 7 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4769-3p |
|
| Accession | MIMAT0019923 |
| Sequence |
48 - ucugccauccucccuccccuac - 69 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|