|
miRBase |
|
Stem-loop sequence hsa-mir-4766 |
|||||
| Accession | MI0017407 | ||||
| Description | Homo sapiens miR-4766 stem-loop | ||||
| Stem-loop |
g c ug g uuu cu aag uccuuc aaagagcaguug uguuua u || ||| |||||| |||||||||||| |||||| ga uuc aggaag uuucucguuaac auaaau u g a gu g cau |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4766-5p |
|
| Accession | MIMAT0019917 |
| Sequence |
12 - ucugaaagagcaguugguguu - 32 |
| Deep sequencing | 5 reads, 4 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-4766-3p |
|
| Accession | MIMAT0019918 |
| Sequence |
46 - auagcaauugcucuuuuggaa - 66 |
| Deep sequencing | 7 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|